Inhibin alpha (INHA) (NM_002191) Human 3' UTR Clone

CAT#: SC201895

3' UTR clone of inhibin alpha (INHA) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Inhibin alpha (INHA) (NM_002191) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_002191
Insert Size 215 bp
Sequence Data
>SC201895 3’UTR clone of NM_002191
The sequence shown below is from the reference sequence of NM_002191. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTTCTCACGCAGCACTGTGCTTGTATCTAAGGGTGGGGGGTCTTCCTTCTTAATCCCATGGCTGGTGGC
CACGCCCCCACCATCATCAGCTGGGAGGAAAGGCAGAGTTGGGAAATAGATGGCTCCCACTCCTCCCTC
CTTTCACTTCTCTGCCTATGGGCTACCCTCCCCACCCCACTTCTATCTCAATAAAGAACACAGTGCATA
TGACTTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002191.4
Summary This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate multiple peptide products, including the alpha subunit of the inhibin A and B protein complexes. These complexes negatively regulate follicle stimulating hormone secretion from the pituitary gland. Inhibins have also been implicated in regulating numerous cellular processes including cell proliferation, apoptosis, immune response and hormone secretion. Mutations in this gene may be associated with male infertility and premature ovarian failure in female human patients. [provided by RefSeq, Aug 2016]
Locus ID 3623
MW 7.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...