CTRP4 (C1QTNF4) (NM_031909) Human 3' UTR Clone

CAT#: SC201894

3' UTR clone of C1q and tumor necrosis factor related protein 4 (C1QTNF4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CTRP4 (C1QTNF4) (NM_031909) Human 3' UTR Clone
Vector pMirTarget
Synonyms CTRP4; ZACRP4
ACCN NM_031909
Insert Size 184 bp
Sequence Data
>SC201894 3’UTR clone of NM_031909
The sequence shown below is from the reference sequence of NM_031909. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCGGGCCTCGGGGCCTCGGAGCTACTGTGAGCCCCGGGCCAGAGAAGAGCCCGGGAGGGCCAGGGGCGT
GCATGCCAGGCCGGGCCGGAGGCTCGAAAGTCCCGCGCGAGCGCCACGGCCTCCGGGCGCGCCTGGACT
CTGCCAATAAAGCGGAAAGCGGGCACGCGCAGCGCCCGGCAGCCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_031909.3
Synonyms CTRP4; ZACRP4
Summary May be involved in the regulation of the inflammatory network. Its role as pro- or anti-inflammatory seems to be context dependent (PubMed:21658842, PubMed:27086950). Seems to have some role in regulating food intake and energy balance when administered in the brain. This effect is sustained over a two-day period, and it is accompanied by decreased expression of orexigenic neuropeptides in the hypothalamus 3 h post-injection (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 114900
MW 6.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...