GPR18 (NM_005292) Human 3' UTR Clone

CAT#: SC201889

3' UTR clone of G protein-coupled receptor 18 (GPR18) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name GPR18 (NM_005292) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_005292
Insert Size 168 bp
Sequence Data
>SC201889 3’UTR clone of NM_005292
The sequence shown below is from the reference sequence of NM_005292. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTAAGCAATATAAACAGTGAAATGTTATGAATAATAAGGTTCTTTCATTTCAATCCCATCAAAATTCAC
TTCACTAACTACTCTGGCGTCAATGGATATTCTGTATAATACTATCAAGTCCCTTTTCTCTTGAAAAAA
TAAATTCATTATCTTCATTTTAAAAACTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005292.4
Summary Receptor for endocannabinoid N-arachidonyl glycine (NAGly) (PubMed:16844083, PubMed:24762058, PubMed:27572937). However, conflicting results about the role of NAGly as an agonist are reported (PubMed:27018161). Can also be activated by plant-derived and synthetic cannabinoid agonists (PubMed:24762058). The activity of this receptor is mediated by G proteins which inhibit adenylyl cyclase (PubMed:16844083). May contribute to regulation of the immune system. Is required for normal homeostasis of CD8+ subsets of intraepithelial lymphocytes (IELs) (CD8alphaalpha and CD8alphabeta IELs)in small intstine by supporting preferential migration of CD8alphaalpha T-cells to intraepithelial compartment over lamina propria compartment, and by mediating their reconstitution into small intestine after bone marrow transplant (By similarity). Plays a role in hypotensive responses, mediating reduction in intraocular and blood pressure (By similarity). Mediates NAGly-induced process of reorganization of actin filaments and induction of acrosomal exocytosis (PubMed:27572937).[UniProtKB/Swiss-Prot Function]
Locus ID 2841
MW 6.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...