HSF4 (NM_001538) Human 3' UTR Clone

CAT#: SC201870

3' UTR clone of heat shock transcription factor 4 (HSF4) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HSF4 (NM_001538) Human 3' UTR Clone
Vector pMirTarget
Synonyms CTM; CTRCT5
ACCN NM_001538
Insert Size 186 bp
Sequence Data
>SC201870 3’UTR clone of NM_001538
The sequence shown below is from the reference sequence of NM_001538. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTGGGCCCGGAAGCCAGTCCCTCCCCCTAAGACCCCGCGCCTCTGAAGGGGCTTGGAACCAGTCCGCCG
CTGCACATCCTTCTTGGCTTCCTGGCGCCCCCTATCGGGGGTGAGCGAAGCCCCCACTACTAAATGGCC
TCTCTCCACTACCCCGACTATCCCTGCACATAAACTCCGTTTTTTTTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001538.4
Synonyms CTM; CTRCT5
Summary Heat-shock transcription factors (HSFs) activate heat-shock response genes under conditions of heat or other stresses. HSF4 lacks the carboxyl-terminal hydrophobic repeat which is shared among all vertebrate HSFs and has been suggested to be involved in the negative regulation of DNA binding activity. Two alternatively spliced transcripts encoding distinct isoforms and possessing different transcriptional activity have been described. [provided by RefSeq, Jul 2008]
Locus ID 3299
MW 6.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...