OXCT2 (NM_022120) Human 3' UTR Clone

CAT#: SC201859

3' UTR clone of 3-oxoacid CoA transferase 2 (OXCT2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name OXCT2 (NM_022120) Human 3' UTR Clone
Vector pMirTarget
Synonyms FKSG25; SCOTT
ACCN NM_022120
Insert Size 178 bp
Sequence Data
>SC201859 3' UTR clone of NM_022120
The sequence shown below is from the reference sequence of NM_022120. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCATGCAGCAGGTGGCACCCTGACGGGACCTGGATCTGGGCGGGGTGGTGCGCTCCTCAGGGCGGGTGCC
ACCGGGTTCCCCAGGGGAATACATGTCCCCAGCTCTGGGAGGGGTTTGCTACTGGCCTCCTACTTTCCTC
CCTAGGTGGACAGTGCTCCTCTAGAGAGCTGCGACTTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_022120.1
Synonyms FKSG25; SCOTT
Summary The protein encoded by this gene catalyzes the transfer of a CoA group from succinate to acetoacetate and is an important enzyme in ketone body catabolism. The encoded protein localizes to the mitochondrion. This gene is intronless, and a pseudogene of this gene is located elsewhere on chromosome 1. [provided by RefSeq, Aug 2016]
Locus ID 64064
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...