MAP4K1 (NM_007181) Human 3' UTR Clone

CAT#: SC201848

3' UTR clone of mitogen-activated protein kinase kinase kinase kinase 1 (MAP4K1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MAP4K1 (NM_007181) Human 3' UTR Clone
Vector pMirTarget
Synonyms HPK1
ACCN NM_007181
Insert Size 199 bp
Sequence Data
>SC201848 3’UTR clone of NM_007181
The sequence shown below is from the reference sequence of NM_007181. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCCGAGTAGCTGGGATTACAGGCCTGTAGTGGTGGAGACACGCCCAGTGGATGATCCTACTGCTCCCA
GCAACCTCTACATCCAGGAATGAGTCCCTAGGGGGGTGTCAGGAACTAGTCCTTGCACCCCCTCCCCCA
TAGACACACTAGTGGTCATGGCATGTCCTCATCTCCCAATAAACATGACTTTAGCCTCTGC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_007181.6
Synonyms HPK1
Summary Serine/threonine-protein kinase, which may play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway. May play a role in hematopoietic lineage decisions and growth regulation. Able to autophosphorylate.[UniProtKB/Swiss-Prot Function]
Locus ID 11184
MW 7.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...