Galectin 3 (LGALS3) (NM_002306) Human 3' UTR Clone

CAT#: SC201846

3' UTR clone of lectin galactoside-binding soluble 3 (LGALS3) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Galectin 3 (LGALS3) (NM_002306) Human 3' UTR Clone
Vector pMirTarget
Synonyms CBP35; GAL3; GALBP; GALIG; L31; LGALS2; MAC2
ACCN NM_002306
Insert Size 182 bp
Sequence Data
>SC201846 3’UTR clone of NM_002306
The sequence shown below is from the reference sequence of NM_002306. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCACCAGTGCTTCATATACCATGATATAATCTGAAAGGGGCAGATTAAAAAAAAAAAAAGAATCTAAA
CCTTACATGTGTAAAGGTTTCATGTTCACTGTGAGTGAAAATTTTTACATTCATCAATATCCCTCTTGT
AAGTCATCTACTTAATAAATATTACAGTGAATTACCTGTCTCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002306.4
Synonyms CBP35; GAL3; GALBP; GALIG; L31; LGALS2; MAC2
Summary This gene encodes a member of the galectin family of carbohydrate binding proteins. Members of this protein family have an affinity for beta-galactosides. The encoded protein is characterized by an N-terminal proline-rich tandem repeat domain and a single C-terminal carbohydrate recognition domain. This protein can self-associate through the N-terminal domain allowing it to bind to multivalent saccharide ligands. This protein localizes to the extracellular matrix, the cytoplasm and the nucleus. This protein plays a role in numerous cellular functions including apoptosis, innate immunity, cell adhesion and T-cell regulation. The protein exhibits antimicrobial activity against bacteria and fungi. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2014]
Locus ID 3958
MW 7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...