HSD17B8 (NM_014234) Human 3' UTR Clone

CAT#: SC201842

3' UTR clone of hydroxysteroid (17-beta) dehydrogenase 8 (HSD17B8) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HSD17B8 (NM_014234) Human 3' UTR Clone
Vector pMirTarget
Synonyms D6S2245E; dJ1033B10.9; FABG; FABGL; H2-KE6; HKE6; KE6; RING2; SDR30C1
ACCN NM_014234
Insert Size 202 bp
Sequence Data
>SC201842 3' UTR clone of NM_014234
The sequence shown below is from the reference sequence of NM_014234. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAAGTCACTGGAGGTCTTTTCATGTAACTGCCTCAAGGACCCTGGACTCTGCTCACCCCCCCACCACTC
TGCCTGGCCTCCTGCTGATGAGGACTCTAAGTTCCCAGGATACAAAAGGGGTGGCAGTGTATGGTTCAGG
AATGCTGAATATGGGAAGCAGGGGTGCTTGTGACCCTAATAAATTCCAAGTCCTCTTCCCTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014234.3
Synonyms D6S2245E; dJ1033B10.9; FABG; FABGL; H2-KE6; HKE6; KE6; RING2; SDR30C1
Summary In mice, the Ke6 protein is a 17-beta-hydroxysteroid dehydrogenase that can regulate the concentration of biologically active estrogens and androgens. It is preferentially an oxidative enzyme and inactivates estradiol, testosterone, and dihydrotestosterone. However, the enzyme has some reductive activity and can synthesize estradiol from estrone. The protein encoded by this gene is similar to Ke6 and is a member of the short-chain dehydrogenase superfamily. An alternatively spliced transcript of this gene has been detected, but the full-length nature of this variant has not been determined. [provided by RefSeq, Jul 2008]
Locus ID 7923
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...