UCHL3 (NM_006002) Human 3' UTR Clone

CAT#: SC201837

3' UTR clone of ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) (UCHL3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name UCHL3 (NM_006002) Human 3' UTR Clone
Vector pMirTarget
Synonyms UCH-L3
ACCN NM_006002
Insert Size 238 bp
Sequence Data
>SC201837 3’UTR clone of NM_006002
The sequence shown below is from the reference sequence of NM_006002. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTTAATGCGATTGCTCTTTCTGCAGCATAGCTTGTCAATAATGGAAACACCAAAAACTGTATTATTTGC
AACTAAATTTTCTCTGCCATACACTAACTCAAAAATTTTGATATTTTCATTAACTTGATGATTAAACTT
TATGTGAGTTAAACTTTGCCTTAACCTGTGTTTTATGTTATTTTTGCTCCAGGTTAAAGGTGCAATGCT
TTCCTCCTCTTTTCTTGTGAAGGATTTATCT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006002.5
Synonyms UCH-L3
Summary The protein encoded by this gene is a member of the deubiquitinating enzyme family. Members of this family are proteases that catalyze the removal of ubiquitin from polypeptides and are divided into five classes, depending on the mechanism of catalysis. This protein may hydrolyze the ubiquitinyl-N-epsilon amide bond of ubiquitinated proteins to regenerate ubiquitin for another catalytic cycle. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Locus ID 7347
MW 8.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...