LSM7 (NM_016199) Human 3' UTR Clone

CAT#: SC201823

3' UTR clone of LSM7 homolog U6 small nuclear RNA associated (S. cerevisiae) (LSM7) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name LSM7 (NM_016199) Human 3' UTR Clone
Vector pMirTarget
Synonyms YNL147W
ACCN NM_016199
Insert Size 189 bp
Sequence Data
>SC201823 3’UTR clone of NM_016199
The sequence shown below is from the reference sequence of NM_016199. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACCCCTTCATCCAGCAGCAGGACGCCTAGCCTGGCCGGGGGCGCGGGGGGTGCAGGGCAGGCCCGAGC
AGCTCGGTTTCCCGCGGACTTGGCTGCTGCTCCCACCGCAGTACCGCCTCCTGGAACGGAAGCATTTTC
CTTTTTGTATAGGTTGAATTTTTGTTTTCTTAATAAAATTGCAAACCTCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016199.3
Synonyms YNL147W
Summary Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing.[supplied by OMIM, Apr 2004]
Locus ID 51690
MW 6.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...