Cytokeratin 14 (KRT14) (NM_000526) Human 3' UTR Clone

CAT#: SC201784

3' UTR clone of keratin 14 (KRT14) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Cytokeratin 14 (KRT14) (NM_000526) Human 3' UTR Clone
Vector pMirTarget
Synonyms CK14; EBS3; EBS4; K14; NFJ
ACCN NM_000526
Insert Size 186 bp
Sequence Data
>SC201784 3’UTR clone of NM_000526
The sequence shown below is from the reference sequence of NM_000526. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACGAGCAGGTCCTTCGCACCAAGAACTGAGGCTGCCCAGCCCCGCTCAGGCCTAGGAGGCCCCCCGTG
TGGACACAGATCCCACTGGAAGATCCCCTCTCCTGCCCAAGCACTTCACAGCTGGACCCTGCTTCACCC
TCACCCCCTCCTGGCAATCAATACAGCTTCATTATCTGAGTTGCATAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000526.5
Synonyms CK14; EBS3; EBS4; K14; NFJ
Summary This gene encodes a member of the keratin family, the most diverse group of intermediate filaments. This gene product, a type I keratin, is usually found as a heterotetramer with two keratin 5 molecules, a type II keratin. Together they form the cytoskeleton of epithelial cells. Mutations in the genes for these keratins are associated with epidermolysis bullosa simplex. At least one pseudogene has been identified at 17p12-p11. [provided by RefSeq, Jul 2008]
Locus ID 3861
MW 6.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...