RED (IK) (NM_006083) Human 3' UTR Clone

CAT#: SC201750

3' UTR clone of IK cytokine down-regulator of HLA II (IK) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RED (IK) (NM_006083) Human 3' UTR Clone
Vector pMirTarget
Synonyms CSA2; RED; RER
ACCN NM_006083
Insert Size 181 bp
Sequence Data
>SC201750 3’UTR clone of NM_006083
The sequence shown below is from the reference sequence of NM_006083. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGGTTGAAGTCAAAAGACCAAAATACTAATCACTAGTTACAACCAGAGATGCTCCACAAGGATATGCT
CCCCACTGTTTTCTTTCTACAATTTCCAAAGGTTGCAAGATGTTTTTTTGTGGATGAATATAAAATTTT
ATTGTGTAATTACTTGGTTCCATTAAAATTGGTTAACTTGCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006083.4
Synonyms CSA2; RED; RER
Summary The protein encoded by this gene was identified by its RED repeat, a stretch of repeated arginine, glutamic acid and aspartic acid residues. The protein localizes to discrete dots within the nucleus, excluding the nucleolus. Its function is unknown. This gene maps to chromosome 5; however, a pseudogene may exist on chromosome 2. [provided by RefSeq, Jul 2008]
Locus ID 3550
MW 6.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...