SCARA3 (NM_182826) Human 3' UTR Clone

CAT#: SC201726

3' UTR clone of scavenger receptor class A member 3 (SCARA3) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SCARA3 (NM_182826) Human 3' UTR Clone
Vector pMirTarget
Synonyms APC7; CSR; CSR1; MSLR1; MSRL1
ACCN NM_182826
Insert Size 201 bp
Sequence Data
>SC201726 3’UTR clone of NM_182826
The sequence shown below is from the reference sequence of NM_182826. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACACTTTGTTTTCACATAATCGGATATGATATGAAGCCAGCCATAAAGCCCAGGATGACCAAGAATAT
AATTTGAAAATGAATTTGTTTACTATCCTTAATGGTAAGCATCACCTTAAGCACATATTATGCCTTGAG
ACACTAGCCAATTGTGGTACATGAAAATAATTTATAAATAAATAAATTTACCTATATTAGGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_182826.2
Synonyms APC7; CSR; CSR1; MSLR1; MSRL1
Summary This gene encodes a macrophage scavenger receptor-like protein. This protein has been shown to deplete reactive oxygen species, and thus play an important role in protecting cells from oxidative stress. The expression of this gene is induced by oxidative stress. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Locus ID 51435
MW 8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...