ICAM2 (NM_001099788) Human 3' UTR Clone

CAT#: SC201714

3' UTR clone of intercellular adhesion molecule 2 (ICAM2) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ICAM2 (NM_001099788) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD102
ACCN NM_001099788
Insert Size 182 bp
Sequence Data
>SC201714 3’UTR clone of NM_001099788
The sequence shown below is from the reference sequence of NM_001099788. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGGAGGCTGCCCCAGGCCTTCCGGCCATAGCAACCATGAGTGGCATGGCCACCACCACGGTGGTCACTG
GAACTCAGTGTGACTCCTCAGGGTTGAGGTCCAGCCCTGGCTGAAGGACTGTGACAGGCAGCAGAGACT
TGGGACATTGCCTTTTCTAGCCCGAATACAAACACCTGGACTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001099788.2
Synonyms CD102
Summary The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein may play a role in lymphocyte recirculation by blocking LFA-1-dependent cell adhesion. It mediates adhesive interactions important for antigen-specific immune response, NK-cell mediated clearance, lymphocyte recirculation, and other cellular interactions important for immune response and surveillance. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 3384
MW 6.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...