BRDT (NM_207189) Human 3' UTR Clone

CAT#: SC201705

3' UTR clone of bromodomain testis-specific (BRDT) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name BRDT (NM_207189) Human 3' UTR Clone
Vector pMirTarget
Synonyms BRD6; CT9; SPGF21
ACCN NM_207189
Insert Size 177 bp
Sequence Data
>SC201705 3’UTR clone of NM_207189
The sequence shown below is from the reference sequence of NM_207189. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATGACAATGTTTGAAAACAACTTTGATTAAAACTCAGTTTTTAAATTAACCATCAACTTAAAATGAATG
GTAAAAGATCAAAATGCATATGGTAAAATGATTGCTTTCAGATAACAAGATACCAATCTTATATTGTAT
TTTGACTGCTCTAAAATGATTAAACAGTTTTCACTTACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_207189.4
Synonyms BRD6; CT9; SPGF21
Summary BRDT is similar to the RING3 protein family. It possesses 2 bromodomain motifs and a PEST sequence (a cluster of proline, glutamic acid, serine, and threonine residues), characteristic of proteins that undergo rapid intracellular degradation. The bromodomain is found in proteins that regulate transcription. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Locus ID 676
MW 7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...