ATP5MC2 (NM_005176) Human 3' UTR Clone

CAT#: SC201703

3' UTR clone of ATP synthase H+ transporting mitochondrial F0 complex subunit C2 (subunit 9) (ATP5G2) nuclear gene encoding mitochondrial protein transcript variant 2



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ATP5MC2 (NM_005176) Human 3' UTR Clone
Vector pMirTarget
Synonyms ATP5A; ATP5G2
ACCN NM_005176
Insert Size 174 bp
Sequence Data
>SC201703 3’UTR clone of NM_005176
The sequence shown below is from the reference sequence of NM_005176. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTAGCCTTTCTCATCCTCTTTGCCATGTGAAGGAGCCGTCTCCACCTCCCATAGTTCTCCCGCGTCTGG
TTGGCCCCGTGTGTTCCTTTTCCTATACCTCCCCAGGCAGCCTGGGGAACGTGGTTGGCTCAGGGTTTG
ACAGAGAAAAGACAAATAAATACTGTATTAATAAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005176.7
Synonyms ATP5A; ATP5G2
Summary This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and single representatives of the gamma, delta, and epsilon subunits. The proton channel likely has nine subunits (a, b, c, d, e, f, g, F6 and 8). There are three separate genes which encode subunit c of the proton channel and they specify precursors with different import sequences but identical mature proteins. The protein encoded by this gene is one of three precursors of subunit c. This gene has multiple pseudogenes. [provided by RefSeq, Jan 2018]
Locus ID 517
MW 6.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...