AFM (NM_001133) Human 3' UTR Clone

CAT#: SC201659

3' UTR clone of afamin (AFM) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name AFM (NM_001133) Human 3' UTR Clone
Vector pMirTarget
Synonyms ALB2; ALBA; ALF
ACCN NM_001133
Insert Size 196 bp
Sequence Data
>SC201659 3’UTR clone of NM_001133
The sequence shown below is from the reference sequence of NM_001133. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AATGAAGAGAGTCCAAAAATTGGCAACTGAAGCCAGCTGCTGGAGATATGTAAAGAAAAAAGCACCAAA
GGGAAGGCTTCCTATCTGTGTGGTGATGAATCGCATTTCCTGAGAACAAAATAAAAGGATTTTTCTGTA
ACTGTCACCTGAAATAATACATTGCAGCAAGCAATAAACACAACATTTTGTAAAGTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001133.2
Synonyms ALB2; ALBA; ALF
Summary This gene is a member of the albumin gene family, which is comprised of four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The protein encoded by this gene is regulated developmentally, expressed in the liver and secreted into the bloodstream. [provided by RefSeq, Jul 2008]
Locus ID 173
MW 7.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...