KCNK7 (NM_033347) Human 3' UTR Clone

CAT#: SC201633

3' UTR clone of potassium channel subfamily K member 7 (KCNK7) transcript variant A for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name KCNK7 (NM_033347) Human 3' UTR Clone
Vector pMirTarget
Synonyms K2p7.1; TWIK3
ACCN NM_033347
Insert Size 199 bp
Sequence Data
>SC201633 3’UTR clone of NM_033347
The sequence shown below is from the reference sequence of NM_033347. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCAGCTTCAGGACAAGCCCCTGCTTGCTGAAGCGTCAGGTGACCGAGTTCAGCTCCGTAAGGTGGCGGC
ACCTGAGGAGGAAGCAGCCAGGAGTGGCTGGGGAAGAATCTGGAGATGGAGCCGCGGTGAGGGTGGGCG
GGAGGCCTCAGAGGATACTGTTAATCATAAAATGAGCAACGACTTCGGCTATTTTCAACTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_033347.2
Synonyms K2p7.1; TWIK3
Summary This gene encodes a member of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel; however, it may require other non-pore-forming proteins for activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 10089
MW 6.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...