TACC3 (NM_006342) Human 3' UTR Clone

CAT#: SC201628

3' UTR clone of transforming acidic coiled-coil containing protein 3 (TACC3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TACC3 (NM_006342) Human 3' UTR Clone
Vector pMirTarget
Synonyms ERIC-1; ERIC1; maskin; Tacc4
ACCN NM_006342
Insert Size 188 bp
Sequence Data
>SC201628 3’UTR clone of NM_006342
The sequence shown below is from the reference sequence of NM_006342. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACCTCATCTCCAAGATGGAGAAGATCTGACCTCCACGGAGCCGCTGTCCCCGCCCCCCTGCTCCCGTC
TGTCTGTCCTGTCTGATTCTCTTAGGTGTCATGTTCTTTTTTCTGTCTTGTCTTCAACTTTTTTAAAAA
CTAGATTGCTTTGAAAACATGACTCAATAAAAGTTTCCTTTCAATTTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006342.3
Synonyms ERIC-1; ERIC1; maskin; Tacc4
Summary This gene encodes a member of the transforming acidic colied-coil protein family. The encoded protein is a motor spindle protein that may play a role in stabilization of the mitotic spindle. This protein may also play a role in growth a differentiation of certain cancer cells. [provided by RefSeq, Nov 2011]
Locus ID 10460
MW 7.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...