Actin Regulatory Protein CAPG (CAPG) (NM_001747) Human 3' UTR Clone

CAT#: SC201620

3' UTR clone of capping protein (actin filament) gelsolin-like (CAPG) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Actin Regulatory Protein CAPG (CAPG) (NM_001747) Human 3' UTR Clone
Vector pMirTarget
Synonyms AFCP; HEL-S-66; MCP
ACCN NM_001747
Insert Size 170 bp
Sequence Data
>SC201620 3’UTR clone of NM_001747
The sequence shown below is from the reference sequence of NM_001747. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCAAGCAATTTTTCAAGGACTGGAAATGAGGGTGGGCGTCTTCCTGCCCCATGCTCCCCTGCCCCCCA
CCACCTGCCTGCTTGCTTCTCTGGCTGCCTGGTCAGTGCAGAGGTGCCCCCTGCAGATGTTCAATAAAG
GAGACAAGTGCTTTCCCAGCTCTTTTCCTGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001747.4
Synonyms AFCP; HEL-S-66; MCP
Summary This gene encodes a member of the gelsolin/villin family of actin-regulatory proteins. The encoded protein reversibly blocks the barbed ends of F-actin filaments in a Ca2+ and phosphoinositide-regulated manner, but does not sever preformed actin filaments. By capping the barbed ends of actin filaments, the encoded protein contributes to the control of actin-based motility in non-muscle cells. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2012]
Locus ID 822
MW 6.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...