SCAP (NM_012235) Human 3' UTR Clone

CAT#: SC201567

3' UTR clone of SREBF chaperone (SCAP) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SCAP (NM_012235) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_012235
Insert Size 203 bp
Sequence Data
>SC201567 3’UTR clone of NM_012235
The sequence shown below is from the reference sequence of NM_012235. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGCCCTCTGTGCTGGAGAAGCTGGACTGAGCGCAGGGCCTCCTTGCCCAGGCAGGAGGCTGGGGTGCT
GTGTGGGGGCCAATGCACTGAACCTGGACTTGGGGGAAAGAGCCGAGTATCTTCCAGCCGCTGCCTCCT
GACTGTAATAATATTAAACTTTTTTAAAAAACCATATCATCATCTGTCAGGCACTTTGGGAGCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012235.4
Summary This gene encodes a protein with a sterol sensing domain (SSD) and seven WD domains. In the presence of cholesterol, this protein binds to sterol regulatory element binding proteins (SREBPs) and mediates their transport from the ER to the Golgi. The SREBPs are then proteolytically cleaved and regulate sterol biosynthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Locus ID 22937
MW 7.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...