MON1A (NM_001142501) Human 3' UTR Clone

CAT#: SC201549

3' UTR clone of MON1 homolog A (yeast) (MON1A) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MON1A (NM_001142501) Human 3' UTR Clone
Vector pMirTarget
Synonyms SAND1
ACCN NM_001142501
Insert Size 171 bp
Sequence Data
>SC201549 3’UTR clone of NM_001142501
The sequence shown below is from the reference sequence of NM_001142501. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCTTCATTCTCACGCCCCTCACCTATTGATGGGAATGTGTGCGGGCTCAGCCTTCCTGGACACACTAG
GTGTGGGAAGCCATAGGAGCCTCCAGATGGGGGCTGGCCTCTCTTGCCCAGCCAGCGGGCAGGGACTGT
GGGTTGGTGAATGCATTAAAGTGCTTTGGGGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001142501.2
Synonyms SAND1
Summary Plays an important role in membrane trafficking through the secretory apparatus. Not involved in endocytic trafficking to lysosomes (By similarity). Acts in concert with CCZ1, as a guanine exchange factor (GEF) for RAB7, promotes the exchange of GDP to GTP, converting it from an inactive GDP-bound form into an active GTP-bound form (PubMed:23084991).[UniProtKB/Swiss-Prot Function]
Locus ID 84315
MW 6.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...