Complement C4B (C4B) (NM_001002029) Human 3' UTR Clone

CAT#: SC201545

3' UTR clone of complement component 4B (Chido blood group) (C4B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Complement C4B (C4B) (NM_001002029) Human 3' UTR Clone
Vector pMirTarget
Synonyms C4B1; C4B2; C4B3; C4B5; C4B12; C4BD; C4B_2; C4F; CH; CO4; CPAMD3
ACCN NM_001002029
Insert Size 171 bp
Sequence Data
>SC201545 3’UTR clone of NM_001002029
The sequence shown below is from the reference sequence of NM_001002029. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGTATGGCACTCAGGGGTGCCAGGTGTGAGGGCTGCCCTCCCACCTCCGCTGGGAGGAACCTGAACCT
GGGAACCATGAAGCTGGAAGCACTGCTGTGTCCGCTTTCATGAACACAGCCTGGGACCAGGGCATATTA
AAGGCTTTTGGCAGCAAAGTGTCAGTGTTGGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001002029.4
Synonyms C4B1; C4B2; C4B3; C4B5; C4B12; C4BD; C4B_2; C4F; CH; CO4; CPAMD3
Summary This gene encodes the basic form of complement factor 4, and together with the C4A gene, is part of the classical activation pathway. The protein is expressed as a single chain precursor which is proteolytically cleaved into a trimer of alpha, beta, and gamma chains prior to secretion. The trimer provides a surface for interaction between the antigen-antibody complex and other complement components. The alpha chain may be cleaved to release C4 anaphylatoxin, a mediator of local inflammation. Deficiency of this protein is associated with systemic lupus erythematosus. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. Varying haplotypes of this gene cluster exist, such that individuals may have 1, 2, or 3 copies of this gene. In addition, this gene exists as a long form and a short form due to the presence or absence of a 6.4 kb endogenous HERV-K retrovirus in intron 9. [provided by RefSeq, May 2020]
Locus ID 721
MW 6.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...