SERPINB6 (NM_004568) Human 3' UTR Clone

CAT#: SC201544

3' UTR clone of serpin peptidase inhibitor clade B (ovalbumin) member 6 (SERPINB6) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SERPINB6 (NM_004568) Human 3' UTR Clone
Vector pMirTarget
Synonyms CAP; DFNB91; MSTP057; PI-6; PI6; PTI; SPI3
ACCN NM_004568
Insert Size 169 bp
Sequence Data
>SC201544 3’UTR clone of NM_004568
The sequence shown below is from the reference sequence of NM_004568. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCTTCTGCGGCCGCTTTTCCTCTCCGTGAGGACAGGGCAGTCTTGGTGTGCAGCCCCTCTCCTCTCTG
TCCCCTGACACTCCACAGTGTGCCTGCAACCCAAGTGGCCTTATCCGTGCAGTGGTGGCAGTTCAGAAA
TAAAGGGCCCATTTGTGGGATGCCGCATTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004568.6
Synonyms CAP; DFNB91; MSTP057; PI-6; PI6; PTI; SPI3
Summary The protein encoded by this gene is a member of the serpin (serine proteinase inhibitor) superfamily, and ovalbumin(ov)-serpin subfamily. It was originally discovered as a placental thrombin inhibitor. The mouse homolog was found to be expressed in the hair cells of the inner ear. Mutations in this gene are associated with nonsyndromic progressive hearing loss, suggesting that this serpin plays an important role in the inner ear in the protection against leakage of lysosomal content during stress, and that loss of this protection results in cell death and sensorineural hearing loss. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]
Locus ID 5269
MW 5.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...