TSTD1 (NM_001113207) Human 3' UTR Clone

CAT#: SC201485

3' UTR clone of thiosulfate sulfurtransferase (rhodanese)-like domain containing 1 (TSTD1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TSTD1 (NM_001113207) Human 3' UTR Clone
Vector pMirTarget
Synonyms KAT; TST
ACCN NM_001113207
Insert Size 174 bp
Sequence Data
>SC201485 3’UTR clone of NM_001113207
The sequence shown below is from the reference sequence of NM_001113207. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TATAGAGAATGGTTGGAGAAAGAGAGTTAGGCAGGAGGCAGCTTACTGATTGCCACCCCCTGGCCCCTT
AATGGCCACCTTAACTAAGGGTGTGAACGGGCTGACTTGGTGAATTGGGCAACTCCTTATAGTGTTGTG
CACACAAAAGCATCAAATAAAGAACATTTAATCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001113207.2
Synonyms KAT; TST
Summary Thiosulfate:glutathione sulfurtransferase (TST) required to produce S-sulfanylglutathione (GSS(-)), a central intermediate in hydrogen sulfide metabolism (PubMed:24981631). Provides the link between the first step in mammalian H(2)S metabolism performed by the sulfide:quinone oxidoreductase (SQOR) which catalyzes the conversion of H(2)S to thiosulfate, and the sulfur dioxygenase (SDO) which uses GSS(-) as substrate (PubMed:24981631). The thermodynamic coupling of the irreversible SDO and reversible TST reactions provides a model for the physiologically relevant reaction with thiosulfate as the sulfane donor (PubMed:24981631).[UniProtKB/Swiss-Prot Function]
Locus ID 100131187
MW 6.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...