IDUA (NM_000203) Human 3' UTR Clone

CAT#: SC201450

3' UTR clone of iduronidase alpha-L- (IDUA) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name IDUA (NM_000203) Human 3' UTR Clone
Vector pMirTarget
Synonyms IDA; MPS1; MPSI
ACCN NM_000203
Insert Size 201 bp
Sequence Data
>SC201450 3’UTR clone of NM_000203
The sequence shown below is from the reference sequence of NM_000203. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGAGGGCCCCCATCCCCGGGCAATCCATGAGCCTGTGCTGAGCCCCAGTGGGTTGCACCTCCACCGGCA
GTCAGCGAGCTGGGGCTGCACTGTGCCCATGCTGCCCTCCCATCACCCCCTTTGCAATATATTTTTATA
TTTTATTATTTTCTTTTATATCTTGGTACCAACGCCCCCTTTAAAGCGGCTTTGCACAGGTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000203.5
Synonyms IDA; MPS1; MPSI
Summary This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]
Locus ID 3425
MW 7.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...