MCM7 (NM_182776) Human 3' UTR Clone

CAT#: SC201425

3' UTR clone of minichromosome maintenance complex component 7 (MCM7) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MCM7 (NM_182776) Human 3' UTR Clone
Vector pMirTarget
Synonyms CDC47; MCM2; P1.1-MCM3; P1CDC47; P85MCM; PNAS146; PPP1R104
ACCN NM_182776
Insert Size 234 bp
Sequence Data
>SC201425 3’UTR clone of NM_182776
The sequence shown below is from the reference sequence of NM_182776. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTTCCCGGACACGGATCACTTTTGTCTGATTCCAGCCTGCTTGCAACCCTGGGGTCCTCTTGTTCCCT
GCTGGCCTGCCCCTTGGGAAGGGGCAGTGATGCCTTTGAGGGGAAGGAGGAGCCCCTCTTTCTCCCATG
CTGCACTTACTCCTTTTGCTAATAAAAGTGTTTGTAGATTGTCATCTTCTAGCCTGGGCCTGACTTCCA
TTAAAACAGGGTTTTGTGCGTTTTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_182776.3
Synonyms CDC47; MCM2; P1.1-MCM3; P1CDC47; P85MCM; PNAS146; PPP1R104
Summary The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 6 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. Cyclin D1-dependent kinase, CDK4, is found to associate with this protein, and may regulate the binding of this protein with the tumorsuppressor protein RB1/RB. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Locus ID 4176
MW 8.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...