ARSF (NM_004042) Human 3' UTR Clone

CAT#: SC201393

3' UTR clone of arylsulfatase F (ARSF) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ARSF (NM_004042) Human 3' UTR Clone
Vector pMirTarget
Synonyms ASF
ACCN NM_004042
Insert Size 201 bp
Sequence Data
>SC201393 3’UTR clone of NM_004042
The sequence shown below is from the reference sequence of NM_004042. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGCCTCGGGGTCCTAACGAGAAGAGATAATTACAATCAGGCTACCAGAGGAAGCCTTTGGTCCTAACG
AGAAGAGATAATTACAATCAGGCTACCAAAGGAAGCACTAACTTTGGTGCTTTCAAGTTGGCAAGGAGT
GCATTTAATAGTCAATAAATTCATCTACCATTCCAGATTATTAAAGGCCCACTGGTTGTTCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004042.5
Synonyms ASF
Summary This gene is a member of the sulfatase family, and more specifically, the arylsulfatase subfamily. Members of the subfamily share similarity in sequence and splice sites, and are clustered together on chromosome X, suggesting that they are derived from recent gene duplication events. Sulfatases are essential for the correct composition of bone and cartilage matrix. The activity of this protein, unlike that of arylsulfatase E, is not inhibited by warfarin. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Jan 2011]
Locus ID 416
MW 7.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...