Troponin C (TNNC2) (NM_003279) Human 3' UTR Clone

CAT#: SC201379

3' UTR clone of troponin C type 2 (fast) (TNNC2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Troponin C (TNNC2) (NM_003279) Human 3' UTR Clone
Vector pMirTarget
Synonyms CFAP85; FAP85
ACCN NM_003279
Insert Size 164 bp
Sequence Data
>SC201379 3’UTR clone of NM_003279
The sequence shown below is from the reference sequence of NM_003279. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCCTGAAGATGATGGAGGGCGTGCAGTAAGGAGTGGACAGTCGCCTCTACCAAGATCGCGTGTCCCTA
GGGTGTGGGAGACTCCGCCCTGCCGGGTCCCCACCAGGGAGGCGCGACCCCTTGTGGGTCTTTGTCTGG
AAGGAATAAAAGCAAATGTTCCAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003279.3
Synonyms CFAP85; FAP85
Summary Troponin (Tn), a key protein complex in the regulation of striated muscle contraction, is composed of 3 subunits. The Tn-I subunit inhibits actomyosin ATPase, the Tn-T subunit binds tropomyosin and Tn-C, while the Tn-C subunit binds calcium and overcomes the inhibitory action of the troponin complex on actin filaments. The protein encoded by this gene is the Tn-C subunit. [provided by RefSeq, Jul 2008]
Locus ID 7125
MW 6.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...