NDUFS5 (NM_004552) Human 3' UTR Clone

CAT#: SC201371

3' UTR clone of NADH dehydrogenase (ubiquinone) Fe-S protein 5 15kDa (NADH-coenzyme Q reductase) (NDUFS5) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NDUFS5 (NM_004552) Human 3' UTR Clone
Vector pMirTarget
Synonyms CI-15k; CI15K
ACCN NM_004552
Insert Size 149 bp
Sequence Data
>SC201371 3’UTR clone of NM_004552
The sequence shown below is from the reference sequence of NM_004552. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACATTGGCAAGGGGGAGCCTCGGCCCTGAACAGAGCAGCTGCTGATGTCTGGAGGCTGATTTTCCTGT
TCTCTGTTCTCCACTGGAAAGGTTGTTTACGACAAACCTCCTTGTCAAAGTGTGTAAAAATAAAGGATT
GCTCCATCCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004552.3
Synonyms CI-15k; CI15K
Summary This gene is a member of the NADH dehydrogenase (ubiquinone) iron-sulfur protein family. The encoded protein is a subunit of the NADH:ubiquinone oxidoreductase (complex I), the first enzyme complex in the electron transport chain located in the inner mitochondrial membrane. Alternative splicing results in multiple transcript variants and pseudogenes have been identified on chromosomes 1, 4 and 17. [provided by RefSeq, May 2010]
Locus ID 4725
MW 5.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...