ANKRD16 (NM_001009943) Human 3' UTR Clone

CAT#: SC201341

3' UTR clone of ankyrin repeat domain 16 (ANKRD16) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ANKRD16 (NM_001009943) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_001009943
Insert Size 163 bp
Sequence Data
>SC201341 3’UTR clone of NM_001009943
The sequence shown below is from the reference sequence of NM_001009943. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGCCAAGTTTCTCCTGCAGTCGGGACTGAAGGATTCTGAAGACATCACGGGCACCCTGGCTCAGCAGC
TCCCAAGGAGAGCAGATGTCCTTCAGGGCTCTGGCCATAGCGCAATGACATAAGGATGTTTCCAAGAGG
AGGCAATAAAGTGCATGGTAATTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001009943.3
Summary Required to prevent the misactivation of serine (Ser) with tRNA(Ala) by promoting the hydrolysis of Ser-mischarged tRNA(Ala), thereby playing a role in translational fidelity. Binds directly to the catalytic domain of AARS/AlaRS and captures Ser that is misactivated by AARS/AlaRS, preventing the charging of Ser adenylates to tRNA(Ala) and precluding Ser misincorporation in nascent peptides.[UniProtKB/Swiss-Prot Function]
Locus ID 54522
MW 6.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...