PIG3 (TP53I3) (NM_004881) Human 3' UTR Clone

CAT#: SC201305

3' UTR clone of tumor protein p53 inducible protein 3 (TP53I3) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PIG3 (TP53I3) (NM_004881) Human 3' UTR Clone
Vector pMirTarget
Synonyms PIG3
ACCN NM_004881
Insert Size 176 bp
Sequence Data
>SC201305 3’UTR clone of NM_004881
The sequence shown below is from the reference sequence of NM_004881. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCAAGATCGTCCTGGAACTGCCCCAGTGAAGGAGGATGGGGCAGGACAGGACGCGGCCACCCCAGGCC
TTTCCAGAGCAAACCTGGAGAAGATTCACAATAGACAGGCCAAGAAACCCGGTGCTTCCTCCAGAGCCG
TTTAAAGCTGATATGAGGAAATAAAGAGTGAACTGGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004881.5
Synonyms PIG3
Summary The protein encoded by this gene is similar to oxidoreductases, which are enzymes involved in cellular responses to oxidative stresses and irradiation. This gene is induced by the tumor suppressor p53 and is thought to be involved in p53-mediated cell death. It contains a p53 consensus binding site in its promoter region and a downstream pentanucleotide microsatellite sequence. P53 has been shown to transcriptionally activate this gene by interacting with the downstream pentanucleotide microsatellite sequence. The microsatellite is polymorphic, with a varying number of pentanucleotide repeats directly correlated with the extent of transcriptional activation by p53. It has been suggested that the microsatellite polymorphism may be associated with differential susceptibility to cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Locus ID 9540
MW 7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...