NDUFS6 (NM_004553) Human 3' UTR Clone

CAT#: SC201294

3' UTR clone of NADH dehydrogenase (ubiquinone) Fe-S protein 6 13kDa (NADH-coenzyme Q reductase) (NDUFS6) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NDUFS6 (NM_004553) Human 3' UTR Clone
Vector pMirTarget
Synonyms CI-13kA; CI-13kD-A; CI13KDA; MC1DN9
ACCN NM_004553
Insert Size 162 bp
Sequence Data
>SC201294 3’UTR clone of NM_004553
The sequence shown below is from the reference sequence of NM_004553. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGCTCCAGTTCAGACAGCACCACCACTAGAGCGTGTGGCACGCCGGGGGTCCCGCAGCATCCTGTGAG
CATTTCCGCGGGGAAGCTGAGCACGTGAAGCTCGCTGGTTCTGTGCGAAGGGTATTCCTGGTGCTGAAT
AAAGGGTGTTGCTGTCAAGGCTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004553.6
Synonyms CI-13kA; CI-13kD-A; CI13KDA; MC1DN9
Summary This gene encodes a subunit of the NADH:ubiquinone oxidoreductase (complex I), which is the first enzyme complex in the electron transport chain of mitochondria. This complex functions in the transfer of electrons from NADH to the respiratory chain. The subunit encoded by this gene is one of seven subunits in the iron-sulfur protein fraction. Mutations in this gene cause mitochondrial complex I deficiency, a disease that causes a wide variety of clinical disorders, including neonatal disease and adult-onset neurodegenerative disorders.[provided by RefSeq, Oct 2009]
Locus ID 4726
MW 5.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...