Asparagine synthetase (ASNS) (NM_133436) Human 3' UTR Clone

CAT#: SC201288

3' UTR clone of asparagine synthetase (ASNS) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Asparagine synthetase (ASNS) (NM_133436) Human 3' UTR Clone
Vector pMirTarget
Synonyms ASNSD; TS11
ACCN NM_133436
Insert Size 177 bp
Sequence Data
>SC201288 3’UTR clone of NM_133436
The sequence shown below is from the reference sequence of NM_133436. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCCACTACAAGTCAGCTGTCAAAGCTTAGGTGGTCTTTATGCTGTAATGTGAAAGCAAATATTTCTTC
GTGTTGGATGGGGACTGTGGGTAGATAGGGGAACAATGAGAGTCAACTCAGGCTAACTTGGGTGTGAAA
AAAATAAAAGTCCTAAATCTAAACCATTGCTGTAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_133436.3
Synonyms ASNSD; TS11
Summary The protein encoded by this gene is involved in the synthesis of asparagine. This gene complements a mutation in the temperature-sensitive hamster mutant ts11, which blocks progression through the G1 phase of the cell cycle at nonpermissive temperature. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]
Locus ID 440
MW 6.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...