acyl CoA Thioesterase 2 (ACOT2) (NM_006821) Human 3' UTR Clone

CAT#: SC201282

3' UTR clone of acyl-CoA thioesterase 2 (ACOT2) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name acyl CoA Thioesterase 2 (ACOT2) (NM_006821) Human 3' UTR Clone
Vector pMirTarget
Synonyms CTE-IA; CTE1A; MTE1; PTE2; PTE2A; ZAP128
ACCN NM_006821
Insert Size 172 bp
Sequence Data
>SC201282 3’UTR clone of NM_006821
The sequence shown below is from the reference sequence of NM_006821. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACGAGGGGACAATCCCATCAAAAGTGTAAATTTTATTTGATCATGTGGCCTCTCTGTTGCTAATCTCT
CCTGGAAACATCTGCCACATTTAGTGTGTGTATGTGTATTCATTCTTTTGTTTTTAATAACTAAAGTTT
TTTCCCCTCATTATTAAAATGAATTTACCAGTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006821.6
Synonyms CTE-IA; CTE1A; MTE1; PTE2; PTE2A; ZAP128
Summary This gene encodes a member of the acyl-CoA thioesterase protein family, and is one of four acyl-CoA hydrolase genes located in a cluster on chromosome 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Locus ID 10965
MW 6.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...