Aurora C (AURKC) (NM_001015878) Human 3' UTR Clone

CAT#: SC201279

3' UTR clone of aurora kinase C (AURKC) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Aurora C (AURKC) (NM_001015878) Human 3' UTR Clone
Vector pMirTarget
Synonyms AIE2; AIK3; ARK3; AurC; aurora-C; HEL-S-90; SPGF5; STK13
ACCN NM_001015878
Insert Size 161 bp
Sequence Data
>SC201279 3’UTR clone of NM_001015878
The sequence shown below is from the reference sequence of NM_001015878. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGCCTCCCTGTGCTCAGATGGCTTCCTGAGCCCTGTCTGCCTCTGTTCCCTTTGTGTGTGTTCAGGGA
GCTCTCCTGGCTCTGCCACCTCATTTGTCTTTATTTTTTTCTCTTTTAAGATGTAAGATGCTAATTAAT
AAAAGCTGAATCATTTCATACCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001015878.2
Synonyms AIE2; AIK3; ARK3; AurC; aurora-C; HEL-S-90; SPGF5; STK13
Summary This gene encodes a member of the Aurora subfamily of serine/threonine protein kinases. The encoded protein is a chromosomal passenger protein that forms complexes with Aurora-B and inner centromere proteins and may play a role in organizing microtubules in relation to centrosome/spindle function during mitosis. This gene is overexpressed in several cancer cell lines, suggesting an involvement in oncogenic signal transduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Locus ID 6795
MW 5.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...