PPP2R3B (NM_199326) Human 3' UTR Clone

CAT#: SC201275

3' UTR clone of protein phosphatase 2 (formerly 2A) regulatory subunit B'' beta (PPP2R3B) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PPP2R3B (NM_199326) Human 3' UTR Clone
Vector pMirTarget
Synonyms FLJ60425; NYREN8; PPP2R3L; PPP2R3LY; PR48
ACCN NM_199326
Insert Size 172 bp
Sequence Data
>SC201275 3’UTR clone of NM_199326
The sequence shown below is from the reference sequence of NM_199326. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGCGGGGACGAGGACCTGGAGCCGCTGTGACGCCGCCCGCGAGAACGCCGCCGCGGGGCCGCTCCCCAC
GTGCCACCACCGGGCCACCGCGGCTCGTGTAAAAACTGTTGTGGAAAATGAGTGCGTTTGTACGGAATG
ATAAACTTTTATTTATTCACAGAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_199326.1
Synonyms FLJ60425; NYREN8; PPP2R3L; PPP2R3LY; PR48
Summary Protein phosphatase 2 (formerly named type 2A) is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2 holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B'' family. The B'' family has been further divided into subfamilies. The product of this gene belongs to the beta subfamily of regulatory subunit B''. [provided by RefSeq, Apr 2010]
Locus ID 28227
MW 6.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...