HSP27 (HSPB1) (NM_001540) Human 3' UTR Clone

CAT#: SC201272

3' UTR clone of heat shock 27kDa protein 1 (HSPB1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HSP27 (HSPB1) (NM_001540) Human 3' UTR Clone
Vector pMirTarget
Synonyms CMT2F; HEL-S-102; HMN2B; HS.76067; Hsp25; HSP27; HSP28; SRP27
ACCN NM_001540
Insert Size 149 bp
Sequence Data
>SC201272 3’UTR clone of NM_001540
The sequence shown below is from the reference sequence of NM_001540. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCAAAATCCGATGAGACTGCCGCCAAGTAAAGCCTTAGCCCGGATGCCCACCCCTGCTGCCGCCACTGG
CTGTGCCTCCCCCGCCACCTGTGTGTTCTTTTGATACATTTATCTTCTGTTTTTCTCAAATAAAGTTCA
AAGCAACCACC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001540.5
Synonyms CMT2F; HEL-S-102; HMN2B; HS.76067; Hsp25; HSP27; HSP28; SRP27
Summary This gene encodes a member of the small heat shock protein (HSP20) family of proteins. In response to environmental stress, the encoded protein translocates from the cytoplasm to the nucleus and functions as a molecular chaperone that promotes the correct folding of other proteins. This protein plays an important role in the differentiation of a wide variety of cell types. Expression of this gene is correlated with poor clinical outcome in multiple human cancers, and the encoded protein may promote cancer cell proliferation and metastasis, while protecting cancer cells from apoptosis. Mutations in this gene have been identified in human patients with Charcot-Marie-Tooth disease and distal hereditary motor neuropathy. [provided by RefSeq, Aug 2017]
Locus ID 3315
MW 5.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...