ATP5MD (NM_032747) Human 3' UTR Clone

CAT#: SC201243

3' UTR clone of up-regulated during skeletal muscle growth 5 homolog (mouse) (USMG5) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ATP5MD (NM_032747) Human 3' UTR Clone
Vector pMirTarget
Synonyms bA792D24.4; DAPIT; HCVFTP2; MC5DN6; USMG5
ACCN NM_032747
Insert Size 150 bp
Sequence Data
>SC201243 3’UTR clone of NM_032747
The sequence shown below is from the reference sequence of NM_032747. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAAAAAACTCCAGCTGTGAAAGCAACATAAATGGATTTTAAACTGTCTACGGTTCTTAACCTCATCTGT
TAAGTTCCCATGCCTGGAGAAGCTAATGCCAACTCATCATGTGATAATTCAATTTGTACAATAAATTAT
GAACCTGGAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032747.4
Synonyms bA792D24.4; DAPIT; HCVFTP2; MC5DN6; USMG5
Summary Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation (Probable). Minor subunit required to maintain the ATP synthase population in the mitochondria (PubMed:21345788).[UniProtKB/Swiss-Prot Function]
Locus ID 84833
MW 5.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...