GTF2H4 (NM_001517) Human 3' UTR Clone

CAT#: SC201240

3' UTR clone of general transcription factor IIH polypeptide 4 52kDa (GTF2H4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name GTF2H4 (NM_001517) Human 3' UTR Clone
Vector pMirTarget
Synonyms P52; TFB2; TFIIH
ACCN NM_001517
Insert Size 153 bp
Sequence Data
>SC201240 3’UTR clone of NM_001517
The sequence shown below is from the reference sequence of NM_001517. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTTTGGAAGCGGCAGAAACATAGCTCCTGAGAGCGCGGGACTTGGACACGGACCTCGGCGGGCGGGACT
GGGCGGGGCGGGGCATCAGAACTCAGGTGTTTTTTATTTACGCGTCAGGGCTTTTCTTGTTTAATAAAG
TTATGATAGCTAGCA
AGCGGACCGACTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCC
CAACCTGCCATCACGAGATTTCGATTCCACCGCCGC
Restriction Sites SgfI-RsrII     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001517.5
Synonyms P52; TFB2; TFIIH
Summary Component of the general transcription and DNA repair factor IIH (TFIIH) core complex, which is involved in general and transcription-coupled nucleotide excision repair (NER) of damaged DNA and, when complexed to CAK, in RNA transcription by RNA polymerase II. In NER, TFIIH acts by opening DNA around the lesion to allow the excision of the damaged oligonucleotide and its replacement by a new DNA fragment. In transcription, TFIIH has an essential role in transcription initiation. When the pre-initiation complex (PIC) has been established, TFIIH is required for promoter opening and promoter escape. Phosphorylation of the C-terminal tail (CTD) of the largest subunit of RNA polymerase II by the kinase module CAK controls the initiation of transcription.[UniProtKB/Swiss-Prot Function]
Locus ID 2968
MW 5.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...