PRR14 (NM_024031) Human 3' UTR Clone

CAT#: SC201207

3' UTR clone of proline rich 14 (PRR14) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PRR14 (NM_024031) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_024031
Insert Size 132 bp
Sequence Data
>SC201207 3’UTR clone of NM_024031
The sequence shown below is from the reference sequence of NM_024031. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTAGATCGGGAGCAGCCCCACTGGACCTAGGTGCCCCATCTGTTGGTCATCCATCCTGAAGGGACAGGA
AACCTCCCAGGCAGTTATTTTTTTTTCTCTATATTTCTAGTAAAGTTTTCGATATGTTTCTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_024031.5
Summary The protein encoded by this gene tethers heterochromatin to the nuclear laminar scaffold by binding heterochromatin protein 1 (HP1) and the nuclear lamina. The tether is broken during mitosis and reforms quickly after mitosis, with the encoded protein first binding HP1 and then attaching to the nuclear lamina. This protein also has been shown to promote MyoD activity and skeletal myogenesis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2016]
Locus ID 78994
MW 5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...