DNA Polymerase beta (POLB) (NM_002690) Human 3' UTR Clone

CAT#: SC201205

3' UTR clone of polymerase (DNA directed) beta (POLB) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DNA Polymerase beta (POLB) (NM_002690) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_002690
Insert Size 181 bp
Sequence Data
>SC201205 3’UTR clone of NM_002690
The sequence shown below is from the reference sequence of NM_002690. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACCGGGAACCCAAGGACCGGAGCGAATGAGGCCTGTATCCTCCCTGGCAGACACAACCCAATAGGAGT
CTTAATTTATTTCTTAACCTTTGCTATGTAAGGGTCTTTGGTGTTTTTAAATGATTGTTTCTTCTTCAT
GCTTTTGCTTGCAATGTAGTCAATAAAACCTCATGTACTATTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002690.3
Summary The protein encoded by this gene is a DNA polymerase involved in base excision and repair, also called gap-filling DNA synthesis. The encoded protein, acting as a monomer, is normally found in the cytoplasm, but it translocates to the nucleus upon DNA damage. Several transcript variants of this gene exist, but the full-length nature of only one has been described to date. [provided by RefSeq, Sep 2011]
Locus ID 5423
MW 7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...