P2X5 (P2RX5) (NM_175081) Human 3' UTR Clone

CAT#: SC201198

3' UTR clone of purinergic receptor P2X ligand-gated ion channel 5 (P2RX5) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name P2X5 (P2RX5) (NM_175081) Human 3' UTR Clone
Vector pMirTarget
Synonyms LRH-1; MGC47755; P2X5; P2x5; P2X5R; purinergic receptor P2X, ligand-gated ion channel, 5; purinergic receptor P2X5
ACCN NM_175081
Insert Size 167 bp
Sequence Data
>SC201198 3’UTR clone of NM_175081
The sequence shown below is from the reference sequence of NM_175081. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCGTTGGAGACAAGCTCCAGGCCGGAGTGAGTGGCTGCAGCCTCAGGACCCTGAGGGGTTTCCCAGCCC
CGTGCGGTGGGTCCCAGCCTGAGGGTGGAGTCCTGCCCACTCTGGGAGCCTCACGCTGAGGGAGGAGTC
AGGCTGTCCCAGCGAGGCCCGACGGCCTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_175081.1
Synonyms LRH-1; MGC47755; P2X5; P2x5; P2X5R; purinergic receptor P2X, ligand-gated ion channel, 5; purinergic receptor P2X5
Summary The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream gene, TAX1BP3 (Tax1 binding protein 3). [provided by RefSeq, Mar 2011]
Locus ID 5026
MW 5.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...