Troponin I fast skeletal muscle (TNNI2) (NM_001145829) Human 3' UTR Clone

CAT#: SC201178

3' UTR clone of troponin I type 2 (skeletal fast) (TNNI2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Troponin I fast skeletal muscle (TNNI2) (NM_001145829) Human 3' UTR Clone
Vector pMirTarget
Synonyms AMCD2B; DA2B; DA2B1; FSSV; fsTnI
ACCN NM_001145829
Insert Size 157 bp
Sequence Data
>SC201178 3’UTR clone of NM_001145829
The sequence shown below is from the reference sequence of NM_001145829. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGGAAGAAGATGTTTGAGTCCGAGTCCTAGGCCACTCGCTGCCCCTACGCCTGCCCCGGTGCCCGGCTC
CCAGCAGAACATACTAGGGAGATGCACCCAGAGCCTGCCAGGGAGGGCTGGCCTCACCACCACCGTCAA
TAAAGGATTTGAATCCCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001145829.2
Synonyms AMCD2B; DA2B; DA2B1; FSSV; fsTnI
Summary This gene encodes a fast-twitch skeletal muscle protein, a member of the troponin I gene family, and a component of the troponin complex including troponin T, troponin C and troponin I subunits. The troponin complex, along with tropomyosin, is responsible for the calcium-dependent regulation of striated muscle contraction. Mouse studies show that this component is also present in vascular smooth muscle and may play a role in regulation of smooth muscle function. In addition to muscle tissues, this protein is found in corneal epithelium, cartilage where it is an inhibitor of angiogenesis to inhibit tumor growth and metastasis, and mammary gland where it functions as a co-activator of estrogen receptor-related receptor alpha. This protein also suppresses tumor growth in human ovarian carcinoma. Mutations in this gene cause myopathy and distal arthrogryposis type 2B. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
Locus ID 7136
MW 6.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

其它Troponin I fast skeletal muscle产品

Customer Reviews 
Loading...