VRL1 (TRPV2) (NM_016113) Human 3' UTR Clone

CAT#: SC201170

3' UTR clone of transient receptor potential cation channel subfamily V member 2 (TRPV2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name VRL1 (TRPV2) (NM_016113) Human 3' UTR Clone
Vector pMirTarget
Synonyms VRL; VRL-1; VRL1
ACCN NM_016113
Insert Size 144 bp
Sequence Data
>SC201170 3’UTR clone of NM_016113
The sequence shown below is from the reference sequence of NM_016113. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGCCCGTCCAGCTCCTCCAGTCCAACTGATGGCCCAGATGCAGCAGGAGGCCAGAGGACAGAGCAGAG
GATCTTTCCAACCACATCTGCTGGCTCTGGGGTCCCAGTGAATTCTGGTGGCAAATATATATTTTCACT
AACTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016113.5
Synonyms VRL; VRL-1; VRL1
Summary This gene encodes an ion channel that is activated by high temperatures above 52 degrees Celsius. The protein may be involved in transduction of high-temperature heat responses in sensory ganglia. It is thought that in other tissues the channel may be activated by stimuli other than heat. [provided by RefSeq, Jul 2008]
Locus ID 51393
MW 5.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...