Caspase 1 (CASP1) (NM_033295) Human 3' UTR Clone

Specifications

Product Data
Product Name	Caspase 1 (CASP1) (NM_033295) Human 3' UTR Clone
Vector	pMirTarget
Synonyms	ICE; IL1BC; P45
ACCN	NM_033295
Insert Size	119 bp
Sequence Data	Insert Sequence (showhide) >SC201105 3' UTR clone of NM_033295 The sequence shown below is from the reference sequence of NM_033295. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC CTACCTCTTCCCAGGACATTAAAATAAGGAAACTGTATGAATGTCTGTGGGCAGGAAGTGAAGAGATCCT TCTGTAAAGGTTTTTGGAATTATGTCTGCTGAATAATAAACTTTTTTGA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites	SgfI-MluI
OTI Disclaimer	Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq	NM_033295.2
Synonyms	ICE; IL1BC; P45
Summary	This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
Locus ID	834

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.