EP1 (PTGER1) (NM_000955) Human 3' UTR Clone

CAT#: SC201077

3' UTR clone of prostaglandin E receptor 1 (subtype EP1) 42kDa (PTGER1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name EP1 (PTGER1) (NM_000955) Human 3' UTR Clone
Vector pMirTarget
Synonyms EP1
ACCN NM_000955
Insert Size 124 bp
Sequence Data
>SC201077 3’UTR clone of NM_000955
The sequence shown below is from the reference sequence of NM_000955. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCCGGCACAGCGGCCTCAGCCACTTCTAAGCACAACCAGAGGCCCAACGACTAAGCCAGCCCACCCTG
GGCTGGGCCCAGGTGCGCGGCGCAGAGCCTTTGGGAATAAAAAGCCATTCTGCGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000955.3
Synonyms EP1
Summary The protein encoded by this gene is a member of the G protein-coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). Through a phosphatidylinositol-calcium second messenger system, G-Q proteins mediate this receptor's activity. Knockout studies in mice suggested a role of this receptor in mediating algesia and in regulation of blood pressure. Studies in mice also suggested that this gene may mediate adrenocorticotropic hormone response to bacterial endotoxin. [provided by RefSeq, Jul 2008]
Locus ID 5731
MW 4.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...