FAM108B1 (ABHD17B) (NM_016014) Human 3' UTR Clone

CAT#: SC201071

3' UTR clone of family with sequence similarity 108 member B1 (FAM108B1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FAM108B1 (ABHD17B) (NM_016014) Human 3' UTR Clone
Vector pMirTarget
Synonyms C9orf77; CGI-67; FAM108B1
ACCN NM_016014
Insert Size 159 bp
Sequence Data
>SC201071 3’UTR clone of NM_016014
The sequence shown below is from the reference sequence of NM_016014. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGTGCAGAAACATAAAGAAGGGAAGTGATTTTCTCAAGGTCTACAGTTTTCAATGACGGTACTATGT
ATTCCATTATCTTCTCTTTACCAAACTTAACTGGATTAATATACCAATGATCCTTTCAAATTATATGAC
ATAAACTTATTTGCTCTCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016014.4
Synonyms C9orf77; CGI-67; FAM108B1
Summary Hydrolyzes fatty acids from S-acylated cysteine residues in proteins (PubMed:26701913). Has depalmitoylating activity towards DLG4/PSD95 (PubMed:26701913). Has depalmitoylating activity towards GAP43 (By similarity). Has depalmitoylating activity towards MAP6 (By similarity). Has depalmitoylating activity towards NRAS (PubMed:26701913).[UniProtKB/Swiss-Prot Function]
Locus ID 51104
MW 6.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...