Acid Phosphatase 2 (ACP2) (NM_001131064) Human 3' UTR Clone

CAT#: SC201066

3' UTR clone of acid phosphatase 2 lysosomal (ACP2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Acid Phosphatase 2 (ACP2) (NM_001131064) Human 3' UTR Clone
Vector pMirTarget
Synonyms acid phosphatase 2, lysosomal; Acp-2; LAP; OTTMUSP00000015308
ACCN NM_001131064
Insert Size 160 bp
Sequence Data
>SC201066 3’UTR clone of NM_001131064
The sequence shown below is from the reference sequence of NM_001131064. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGAGTGGCCAGCCCTTCCCTGGGGTGGTGAGGGGACAGCTCTGGCCGTAGGCCTGCTGATGCCAGGCTC
CTTTTCCCGCTGCCTGTTTCCCCGCTTCGCTCTACAGCTGCTGAAGTTCCCGTTGGGCCCATGTCCCCG
TTATGAGCAGCTGCAGAACGAG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001131064.1
Synonyms acid phosphatase 2, lysosomal; Acp-2; LAP; OTTMUSP00000015308
Summary The protein encoded by this gene belongs to the histidine acid phosphatase family, which hydrolyze orthophosphoric monoesters to alcohol and phosphate. This protein is localized to the lysosomal membrane, and is chemically and genetically distinct from the red cell acid phosphatase. Mice lacking this gene showed multiple defects, including bone structure alterations, lysosomal storage defects, and an increased tendency towards seizures. An enzymatically-inactive allele of this gene in mice showed severe growth retardation, hair-follicle abnormalities, and an ataxia-like phenotype. Alternatively spliced transcript variants have been found for this gene. A C-terminally extended isoform is also predicted to be produced by the use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism. [provided by RefSeq, Oct 2017]
Locus ID 53
MW 5.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...