GPAA1 (NM_003801) Human 3' UTR Clone

CAT#: SC201055

3' UTR clone of glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast) (GPAA1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name GPAA1 (NM_003801) Human 3' UTR Clone
Vector pMirTarget
Synonyms GAA1; GPIBD15; hGAA1
ACCN NM_003801
Insert Size 121 bp
Sequence Data
>SC201055 3’UTR clone of NM_003801
The sequence shown below is from the reference sequence of NM_003801. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTTTTCTGGAATGTGCTCTTCTGGAAGTGAGATCTGCCTGTCCGGGCTGGGACAGAGACTCCCCAAGGA
CCCCATTCTGCCTCCTTCTGGGGAAATAAATGAGTGTCTGTTTCAGCAGCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003801.4
Synonyms GAA1; GPIBD15; hGAA1
Summary Posttranslational glycosylphosphatidylinositol (GPI) anchor attachment serves as a general mechanism for linking proteins to the cell surface membrane. The protein encoded by this gene presumably functions in GPI anchoring at the GPI transfer step. The mRNA transcript is ubiquitously expressed in both fetal and adult tissues. The anchor attachment protein 1 contains an N-terminal signal sequence, 1 cAMP- and cGMP-dependent protein kinase phosphorylation site, 1 leucine zipper pattern, 2 potential N-glycosylation sites, and 8 putative transmembrane domains. [provided by RefSeq, Jul 2008]
Locus ID 8733
MW 4.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...